pGE-attB-GMR_mNeonGreen::3XFLAG::dCrk
(Plasmid
#131143)
-
PurposeRescue construct for targeting into crk[ΔattP]. Contains 110bp upstream of transcription start site, mNeonGreen, 3XFLAG, and dCrk cDNA, 3' UTR and 99bp downstream.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131143 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGE-attB-GMR
- Backbone size w/o insert (bp) 6170
- Total vector size (bp) 8304
-
Vector typeInsect Expression, Cre/Lox ; attB recombination site
-
Selectable markersmini-White
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemNeonGreen::3XFLAG::Crk
-
Alt nameCrk
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)2183
-
Entrez GeneCrk (a.k.a. Dmel_CG1587, CG1587, CRK, D-CRK, D-Crk, DCrk, Dcrk, Dmel\CG1587, crk, dCRK, dCrk)
-
Tags
/ Fusion Proteins
- mNeonGreen (N terminal on insert)
- 3XFLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gaattgccggctgtacactt
- 3′ sequencing primer gcgacagagtgagagagcaa
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGE-attB-GMR_mNeonGreen::3XFLAG::dCrk was a gift from Mark Peifer (Addgene plasmid # 131143 ; http://n2t.net/addgene:131143 ; RRID:Addgene_131143) -
For your References section:
The Crk adapter protein is essential for Drosophila embryogenesis, where it regulates multiple actin-dependent morphogenic events. Spracklen AJ, Thornton-Kolbe EM, Bonner AN, Florea A, Compton PJ, Fernandez-Gonzalez R, Peifer M. Mol Biol Cell. 2019 Jul 18:mbcE19050302. doi: 10.1091/mbc.E19-05-0302. 10.1091/mbc.E19-05-0302 PubMed 31318326