pSK234
(Plasmid
#131149)
-
Purpose(Empty Backbone) dual yTRAP, Gateway destination vector of aTF2 fusion reporting on mKate2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131149 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSK247
-
Backbone manufacturerSzilvia Kiriakov
- Backbone size (bp) 10377
-
Modifications to backbonereplaced mNeonGreen reporter with yeast optimized mKate2
-
Vector typeYeast Expression ; Gateway destination vector
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsTG1 strain
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer cgtttacaatttcctgatgcggt
- 3′ sequencing primer cctgagaaagcaacctgacct
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is the empty dual yTRAP sensor plasmid. To sense aggregation of your favorite protein, clone the coding sequence into a pENTR clone, then perform LR reaction with pSK234. The resulting expression clone should be linearized with NotI-HF enzyme prior to integration into the yeast genome. The sensor integrates into the LEU2 locus, and can be selected for using 100 ug/ml G418. It can be used in combination with an expression clone resulting from LR reaction using pGAN147 basic yTRAP sensor.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSK234 was a gift from Ahmad Khalil (Addgene plasmid # 131149 ; http://n2t.net/addgene:131149 ; RRID:Addgene_131149) -
For your References section:
A Genetic Tool to Track Protein Aggregates and Control Prion Inheritance. Newby GA, Kiriakov S, Hallacli E, Kayatekin C, Tsvetkov P, Mancuso CP, Bonner JM, Hesse WR, Chakrabortee S, Manogaran AL, Liebman SW, Lindquist S, Khalil AS. Cell. 2017 Nov 2;171(4):966-979.e18. doi: 10.1016/j.cell.2017.09.041. Epub 2017 Oct 19. 10.1016/j.cell.2017.09.041 PubMed 29056345