pX330_SpCas9_USP7 Exon 3 gRNA
(Plasmid
#131257)
-
PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131257 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-Cbh-hSpCas9
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 42230)
- Backbone size w/o insert (bp) 8506
- Total vector size (bp) 8509
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehumanised S. pyogenes Cas9 nuclease
-
Alt namehSpCas9
-
gRNA/shRNA sequenceAGACCACACCAAAAAAGCGT
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 was from Feng Zhang (Addgene plasmid # 42230)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330_SpCas9_USP7 Exon 3 gRNA was a gift from Roger Woodgate (Addgene plasmid # 131257 ; http://n2t.net/addgene:131257 ; RRID:Addgene_131257) -
For your References section:
DNA Polymerase iota Interacts with Both the TRAF-like and UBL1-2 Domains of USP7. Ashton NW, Valles GJ, Jaiswal N, Bezsonova I, Woodgate R. J Mol Biol. 2021 Jan 22;433(2):166733. doi: 10.1016/j.jmb.2020.166733. Epub 2020 Dec 3. 10.1016/j.jmb.2020.166733 PubMed 33279577