-
PurposeExpress constitutively an NAD-dependent formate dehydrogenase from Pseudomonas sp. 101 in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZE21-MCS
-
Backbone manufacturerExpressys
- Backbone size w/o insert (bp) 1799
- Total vector size (bp) 3023
-
Modifications to backboneSmR gene instead of KanR
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameformate dehydrogenase
-
Alt namefdh
-
SpeciesPseudomonas sp. 101
-
Insert Size (bp)1224
-
GenBank IDP33160
-
Tag
/ Fusion Protein
- his-tag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCTCGAGACCTATTGACAAT
- 3′ sequencing primer TCACCGACAAACAACAGATA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Yehudit Zohar, Weizmann Institute of Science, Rehovot, Israel
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFDH was a gift from Ron Milo (Addgene plasmid # 131706 ; http://n2t.net/addgene:131706 ; RRID:Addgene_131706) -
For your References section:
Conversion of Escherichia coli to Generate All Biomass Carbon from CO2. Gleizer S, Ben-Nissan R, Bar-On YM, Antonovsky N, Noor E, Zohar Y, Jona G, Krieger E, Shamshoum M, Bar-Even A, Milo R. Cell. 2019 Nov 27;179(6):1255-1263.e12. doi: 10.1016/j.cell.2019.11.009. 10.1016/j.cell.2019.11.009 PubMed 31778652