Skip to main content

pLenti-CreLite
(Plasmid #131786)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131786 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV
  • Backbone manufacturer
    VectorBuilder
  • Backbone size w/o insert (bp) 9000
  • Total vector size (bp) 12455
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox, Synthetic Biology
  • Selectable markers
    Puromycin ; mTagBFP2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PhyBCreC-P2A-PIF6CreN
  • Alt name
    CreALite
  • Species
    A. thaliana (mustard weed), Synthetic; Bacteriophage P1
  • Insert Size (bp)
    3507
  • GenBank ID
    816394 825382
  • Promoter CBh

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CBh_F: ttctgcttcactctccccatc
  • 3′ sequencing primer attB2: ccactttgtacaagaaagctgggt
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This plasmid is designed by Shuo-Ting Yen and subcloned by VectorBuilder.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Read the preprint at bioRxiv: doi.org/10.1101/823971.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CreLite was a gift from George Eisenhoffer (Addgene plasmid # 131786 ; http://n2t.net/addgene:131786 ; RRID:Addgene_131786)
  • For your References section:

    CreLite: An optogenetically controlled Cre/loxP system using red light. Yen ST, Trimmer KA, Aboul-Fettouh N, Mullen RD, Culver JC, Dickinson ME, Behringer RR, Eisenhoffer GT. Dev Dyn. 2020 Nov;249(11):1394-1403. doi: 10.1002/dvdy.232. Epub 2020 Aug 31. 10.1002/dvdy.232 PubMed 32745301