Skip to main content

pTol2-PcyA-IRES-HO1
(Plasmid #131787)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131787 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pzTol2
  • Backbone manufacturer
    VectorBuilder
  • Backbone size w/o insert (bp) 2800
  • Total vector size (bp) 6554
  • Vector type
    Mammalian Expression, Synthetic Biology ; Zebrafish Tol2 transposon

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PcyA and HO1
  • Species
    H. sapiens (human), Synthetic; Thermosynechococcus elongatus
  • Insert Size (bp)
    2238
  • Promoter hsp70
  • Tag / Fusion Protein
    • MTS (Mitochondrial Targeting Signal from subunit VIII of human cytochrome C oxidase) (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer attB1: GTTTGTACAAAAAAGCAGGC
  • 3′ sequencing primer IRES-F
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The insert sequences are provided by Dr. Wilfried Weber from the University of Freiberg.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Read the preprint at bioRxiv: doi.org/10.1101/823971.

This vector is designed by Dr. Shuo-Ting Yen from Eisenhoffer lab and synthesized by VectorBuilder.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol2-PcyA-IRES-HO1 was a gift from George Eisenhoffer (Addgene plasmid # 131787 ; http://n2t.net/addgene:131787 ; RRID:Addgene_131787)
  • For your References section:

    CreLite: An optogenetically controlled Cre/loxP system using red light. Yen ST, Trimmer KA, Aboul-Fettouh N, Mullen RD, Culver JC, Dickinson ME, Behringer RR, Eisenhoffer GT. Dev Dyn. 2020 Nov;249(11):1394-1403. doi: 10.1002/dvdy.232. Epub 2020 Aug 31. 10.1002/dvdy.232 PubMed 32745301