Skip to main content
Addgene
Open Menu

SuperNova-TGON3
(Plasmid #131859)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131859 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 131859-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 131859-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SuperNova
  • Species
    Synthetic
  • Promoter CMV
  • Tag / Fusion Protein
    • TGON3 (rat) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Trans-Golgi network targeting was achieved by inserting synthetic DNA coding for TGON3 (rat) with N-terminal SuperNova into pcDNA3.1(+) using restriction sites NheI and XbaI. SuperNova sequence is from: Takemoto, K.; Matsuda, T.; Sakai, N.; Fu, D.; Noda, M.; Uchiyama, S.; Kotera, I.; Arai, Y.; Horiuchi, M.; Fukui, K.; et al. SuperNova, a monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation. Sci. Rep. 2013, 3, 2629.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SuperNova-TGON3 was a gift from Geert van den Bogaart (Addgene plasmid # 131859 ; http://n2t.net/addgene:131859 ; RRID:Addgene_131859)

  • For your References section:

    Radical Stress Is More Cytotoxic in the Nucleus than in Other Organelles. Paardekooper LM, van Vroonhoven E, Ter Beest M, van den Bogaart G. Int J Mol Sci. 2019 Aug 25;20(17). pii: ijms20174147. doi: 10.3390/ijms20174147. 10.3390/ijms20174147 PubMed 31450682
Related items:
Commonly requested with: