pN_35S/mApple
(Plasmid
#132566)
-
PurposemApple expression regulated by the CaMV35S promoter, co-expressed nourseothricin acetyl transferase selectable marker (nat)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepN_35S
- Backbone size w/o insert (bp) 9267
- Total vector size (bp) 9978
-
Vector typePlant Expression
-
Selectable markersNourseothricin/streptothricin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemApple
-
Alt namemApple monomeric red fluorescent protein
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter Cauliflower mosaic virus 35S
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCGGATTCCATTGCCCAGCTAT
- 3′ sequencing primer ATATGCTCAACACATGAGCGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymApple was amplified from mApple-pBAD, a gift from Michael Davidson & Nathan Shaner & Roger Tsien (Addgene plasmid # 54536 ; http://n2t.net/addgene:54536 ; RRID:Addgene_54536).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/852020v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN_35S/mApple was a gift from Mathias Pribil (Addgene plasmid # 132566 ; http://n2t.net/addgene:132566 ; RRID:Addgene_132566) -
For your References section:
Antimicrobial solid media for screening non-sterile Arabidopsis thaliana seeds. Behrendorff JBYH, Borras-Gas G, Pribil M. Physiol Plant. 2020 Feb 25. doi: 10.1111/ppl.13079. 10.1111/ppl.13079 PubMed 32096870