Skip to main content

pAM5411
(Plasmid #132663)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132663 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAM5406
  • Backbone manufacturer
    -
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 9000
  • Modifications to backbone
    Addition of RK2-bom site, pUC19 origin of replication
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin and Streptomycin, 50 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    aadA
  • Insert Size (bp)
    800
  • Promoter PaadA

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGCCAAAAAAAAGCCCGCT
  • 3′ sequencing primer TTCTCCTGCAGGGCCGAGTT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    YFP
  • Insert Size (bp)
    720
  • Promoter PconII

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGCCAAAAAAAAGCCCGCT
  • 3′ sequencing primer TTCTCCTGCAGGGCCGAGTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM5411 was a gift from Susan Golden (Addgene plasmid # 132663 ; http://n2t.net/addgene:132663 ; RRID:Addgene_132663)
  • For your References section:

    Modification of RSF1010-Based Broad-Host-Range Plasmids for Improved Conjugation and Cyanobacterial Bioprospecting. Bishe B, Taton A, Golden JW. iScience. 2019 Oct 25;20:216-228. doi: 10.1016/j.isci.2019.09.002. Epub 2019 Sep 10. 10.1016/j.isci.2019.09.002 PubMed 31585408