-
PurposepRL623-based helper plasmid for conjugations, with RSF1010 mobA gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRL623
-
Backbone manufacturer-
- Backbone size w/o insert (bp) 17500
- Total vector size (bp) 20000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMobA
-
SpeciesRSF1010 plasmid
-
Insert Size (bp)2100
-
Mutationplease see depositor comments below
- Promoter p1,p3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCCTACCGATGAATTCGAG
- 3′ sequencing primer TAATTGACAACAGTTAGAAC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that Addgene found mutations Q291P, P416T, P595S, H623D in mobA during our quality control process. The depositing lab confirmed these mutations do not affect plasmid function, and the plasmid functions as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM5505 was a gift from Susan Golden (Addgene plasmid # 132664 ; http://n2t.net/addgene:132664 ; RRID:Addgene_132664) -
For your References section:
Modification of RSF1010-Based Broad-Host-Range Plasmids for Improved Conjugation and Cyanobacterial Bioprospecting. Bishe B, Taton A, Golden JW. iScience. 2019 Oct 25;20:216-228. doi: 10.1016/j.isci.2019.09.002. Epub 2019 Sep 10. 10.1016/j.isci.2019.09.002 PubMed 31585408