Skip to main content

pAM5505
(Plasmid #132664)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132664 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRL623
  • Backbone manufacturer
    -
  • Backbone size w/o insert (bp) 17500
  • Total vector size (bp) 20000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MobA
  • Species
    RSF1010 plasmid
  • Insert Size (bp)
    2100
  • Mutation
    please see depositor comments below
  • Promoter p1,p3

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCCCTACCGATGAATTCGAG
  • 3′ sequencing primer TAATTGACAACAGTTAGAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene found mutations Q291P, P416T, P595S, H623D in mobA during our quality control process. The depositing lab confirmed these mutations do not affect plasmid function, and the plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM5505 was a gift from Susan Golden (Addgene plasmid # 132664 ; http://n2t.net/addgene:132664 ; RRID:Addgene_132664)
  • For your References section:

    Modification of RSF1010-Based Broad-Host-Range Plasmids for Improved Conjugation and Cyanobacterial Bioprospecting. Bishe B, Taton A, Golden JW. iScience. 2019 Oct 25;20:216-228. doi: 10.1016/j.isci.2019.09.002. Epub 2019 Sep 10. 10.1016/j.isci.2019.09.002 PubMed 31585408