-
PurposePrime editing in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepU6
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPick pink/red colonies. Growth at 30C helps promote plasmid stability.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExchangeable cassette
-
Alt namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)821
-
MutationSee manuscript
- Promoter U6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
BsaI sites are located at positions 245 and 1070.
Please note that bacterial colonies for this plasmid often appear pink or red in color because of expression of the RFP insert.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-pegRNA-GG-acceptor was a gift from David Liu (Addgene plasmid # 132777 ; http://n2t.net/addgene:132777 ; RRID:Addgene_132777) -
For your References section:
Search-and-replace genome editing without double-strand breaks or donor DNA. Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR. Nature. 2019 Oct 21. pii: 10.1038/s41586-019-1711-4. doi: 10.1038/s41586-019-1711-4. 10.1038/s41586-019-1711-4 PubMed 31634902