-
PurposeS. pyogenes pegRNA for CTT insertion at the HEK3 site of human cells using prime editing
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132778 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepU6
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHEK3_CTT_ins pegRNA
-
gRNA/shRNA sequenceGGCCCAGACTGAGCACGTGA
-
SpeciesSynthetic
-
Insert Size (bp)821
-
MutationSee manuscript
- Promoter U6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert size: 122 bp.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-Sp-pegRNA-HEK3_CTT_ins was a gift from David Liu (Addgene plasmid # 132778 ; http://n2t.net/addgene:132778 ; RRID:Addgene_132778) -
For your References section:
Search-and-replace genome editing without double-strand breaks or donor DNA. Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR. Nature. 2019 Oct 21. pii: 10.1038/s41586-019-1711-4. doi: 10.1038/s41586-019-1711-4. 10.1038/s41586-019-1711-4 PubMed 31634902