1647_pGL4.51 TLV41 SSA-Luc cloning vector_Circular
(Plasmid
#132962)
-
PurposeFirefly-luciferase single-strand annealing assay cloning backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL4.51
-
Backbone manufacturerPromega
- Total vector size (bp) 6727
-
Modifications to backboneStop sequences between Firefly Luciferase sequence
-
Vector typeMammalian Expression, CRISPR, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFirefly Luciferase
-
SpeciesSynthetic
-
MutationStop sequence between luciferase gene
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (destroyed during cloning)
- 3′ cloning site SbfI (destroyed during cloning)
- 5′ sequencing primer TTACCGACGCACATATCGAG
- 3′ sequencing primer TGACTGAATCGGACACAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1647_pGL4.51 TLV41 SSA-Luc cloning vector_Circular was a gift from Gang Bao (Addgene plasmid # 132962 ; http://n2t.net/addgene:132962 ; RRID:Addgene_132962) -
For your References section:
High-throughput cellular screening of engineered nuclease activity using the single-strand annealing assay and luciferase reporter. Cradick TJ, Antico CJ, Bao G. Methods Mol Biol. 2014;1114:339-52. doi: 10.1007/978-1-62703-761-7_22. 10.1007/978-1-62703-761-7_22 PubMed 24557914