1647_pGL4.51 TLV41 SSA-Luc cloning vector_Circular
(Plasmid
#132962)
-
PurposeFirefly-luciferase single-strand annealing assay cloning backbone
-
Depositing Lab
-
Depositing OrganizationRice University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 132962-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 132962-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL4.51
-
Backbone manufacturerPromega
- Total vector size (bp) 6727
-
Modifications to backboneStop sequences between Firefly Luciferase sequence
-
Vector typeMammalian Expression, CRISPR, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFirefly Luciferase
-
SpeciesSynthetic
-
MutationStop sequence between luciferase gene
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (destroyed during cloning)
- 3′ cloning site SbfI (destroyed during cloning)
- 5′ sequencing primer TTACCGACGCACATATCGAG
- 3′ sequencing primer TGACTGAATCGGACACAAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 132962-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 132962-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1647_pGL4.51 TLV41 SSA-Luc cloning vector_Circular was a gift from Gang Bao (Addgene plasmid # 132962 ; http://n2t.net/addgene:132962 ; RRID:Addgene_132962) -
For your References section:
High-throughput cellular screening of engineered nuclease activity using the single-strand annealing assay and luciferase reporter. Cradick TJ, Antico CJ, Bao G. Methods Mol Biol. 2014;1114:339-52. doi: 10.1007/978-1-62703-761-7_22. 10.1007/978-1-62703-761-7_22 PubMed 24557914
Map uploaded by the depositor.
