pDR-nfatc1_sgRNA2
(Plasmid
#132978)
-
Purposenfatc1 sgRNA targeting to "5'-GTGGGAGCTCCATTGGATCG-3" in pDR274
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDR274
- Backbone size w/o insert (bp) 2126
- Total vector size (bp) 2145
-
Vector typeCRISPR ; sgRNA generation vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenfatc1 sgRNA2 target sequence
-
gRNA/shRNA sequenceGTGGGAGCTCCATTGGATCG
-
SpeciesD. rerio (zebrafish)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer M13R-pUC
- 3′ sequencing primer M13F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDR-nfatc1_sgRNA2 was a gift from Nathan Lawson (Addgene plasmid # 132978 ; http://n2t.net/addgene:132978 ; RRID:Addgene_132978) -
For your References section:
Valves Are a Conserved Feature of the Zebrafish Lymphatic System. Shin M, Nozaki T, Idrizi F, Isogai S, Ogasawara K, Ishida K, Yuge S, Roscoe B, Wolfe SA, Fukuhara S, Mochizuki N, Deguchi T, Lawson ND. Dev Cell. 2019 Nov 4;51(3):374-386.e5. doi: 10.1016/j.devcel.2019.08.019. Epub 2019 Sep 26. 10.1016/j.devcel.2019.08.019 PubMed 31564611