pMDH
(Plasmid
#133129)
-
PurposeA recombinant plasmid expressing mdh (malate dehydrogenase) gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133129 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLGZ920
-
Backbone manufacturerPil Kim
- Backbone size w/o insert (bp) 5403
- Total vector size (bp) 6563
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemalate dehydrogenase gene
-
Alt namemdh
-
SpeciesActinobacillus succinogenes
-
Insert Size (bp)1350
- Promoter malate dehydrogenase promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGAACCGAAGCGTTCCTGCGCGAGTAACGC
- 3′ sequencing primer GCTTCCCATTAATCAAACGGCGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMDH was a gift from Gregg Beckham (Addgene plasmid # 133129 ; http://n2t.net/addgene:133129 ; RRID:Addgene_133129) -
For your References section:
Metabolic Engineering of Actinobacillus succinogenes Provides Insights into Succinic Acid Biosynthesis. Guarnieri MT, Chou YC, Salvachua D, Mohagheghi A, St John PC, Peterson DJ, Bomble YJ, Beckham GT. Appl Environ Microbiol. 2017 Aug 17;83(17). pii: AEM.00996-17. doi: 10.1128/AEM.00996-17. Print 2017 Sep 1. 10.1128/AEM.00996-17 PubMed 28625987