Skip to main content

human ETV6 gRNA-4
(Plasmid #133404)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133404 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 133404-D50 50 μg of DNA in Tris buffer $495
DNA 133404-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    gRNA_Cloning Vector(Addgene#41824)
  • Backbone manufacturer
    George Church
  • Backbone size w/o insert (bp) 3915
  • Total vector size (bp) 3974
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ETV6
  • gRNA/shRNA sequence
    CGGGTCACGAACACTCACGC
  • Species
    H. sapiens (human)
  • Entrez Gene
    ETV6 (a.k.a. TEL, TEL/ABL, THC5)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    human ETV6 gRNA-4 was a gift from Linzhao Cheng (Addgene plasmid # 133404 ; http://n2t.net/addgene:133404 ; RRID:Addgene_133404)
  • For your References section:

    Conditional gene knockout and reconstitution in human iPSCs with an inducible Cas9 system. Wu M, Liu S, Gao Y, Bai H, Machairaki V, Li G, Chen T, Cheng L. Stem Cell Res. 2018 May;29:6-14. doi: 10.1016/j.scr.2018.03.003. Epub 2018 Mar 10. 10.1016/j.scr.2018.03.003 PubMed 29554589