Skip to main content

pCAMKIIa-TetOn3G
(Plasmid #133727)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133727 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV-cDNA6-V5His
  • Backbone manufacturer
    Vector Bioloabs
  • Backbone size w/o insert (bp) 3743
  • Total vector size (bp) 4490
  • Modifications to backbone
    Promoter and Insert were inserted between the AAV2 ITRs using Gibson cloning.
  • Vector type
    Mammalian Expression, AAV
  • Selectable markers
    No selectable marker

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TetOn3G
  • Species
    Synthetic
  • Insert Size (bp)
    747
  • Promoter pCamk2a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGTCTAGACTGGACAAGAGC
  • 3′ sequencing primer TTACCCGGGGAGCATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAMKIIa-TetOn3G was a gift from Erin Schuman (Addgene plasmid # 133727 ; http://n2t.net/addgene:133727 ; RRID:Addgene_133727)
  • For your References section:

    A genetically encodable cell-type-specific protein synthesis inhibitor. Heumuller M, Glock C, Rangaraju V, Biever A, Schuman EM. Nat Methods. 2019 Jul 15. pii: 10.1038/s41592-019-0468-x. doi: 10.1038/s41592-019-0468-x. 10.1038/s41592-019-0468-x PubMed 31308551