pCAMKIIa-TetOn3G
(Plasmid
#133727)
-
PurposePlasmid contains the TetOn3G-transactivator sequence under control of a Camk2a promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV-cDNA6-V5His
-
Backbone manufacturerVector Bioloabs
- Backbone size w/o insert (bp) 3743
- Total vector size (bp) 4490
-
Modifications to backbonePromoter and Insert were inserted between the AAV2 ITRs using Gibson cloning.
-
Vector typeMammalian Expression, AAV
-
Selectable markersNo selectable marker
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetOn3G
-
SpeciesSynthetic
-
Insert Size (bp)747
- Promoter pCamk2a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTCTAGACTGGACAAGAGC
- 3′ sequencing primer TTACCCGGGGAGCATG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAMKIIa-TetOn3G was a gift from Erin Schuman (Addgene plasmid # 133727 ; http://n2t.net/addgene:133727 ; RRID:Addgene_133727) -
For your References section:
A genetically encodable cell-type-specific protein synthesis inhibitor. Heumuller M, Glock C, Rangaraju V, Biever A, Schuman EM. Nat Methods. 2019 Jul 15. pii: 10.1038/s41592-019-0468-x. doi: 10.1038/s41592-019-0468-x. 10.1038/s41592-019-0468-x PubMed 31308551