Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #133727)


Item Catalog # Description Quantity Price (USD)
Plasmid 133727 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Vector Bioloabs
  • Backbone size w/o insert (bp) 3743
  • Total vector size (bp) 4490
  • Modifications to backbone
    Promoter and Insert were inserted between the AAV2 ITRs using Gibson cloning.
  • Vector type
    Mammalian Expression, AAV
  • Selectable markers
    No selectable marker

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter pCamk2a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGTCTAGACTGGACAAGAGC
  • 3′ sequencing primer TTACCCGGGGAGCATG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAMKIIa-TetOn3G was a gift from Erin Schuman (Addgene plasmid # 133727 ; ; RRID:Addgene_133727)
  • For your References section:

    A genetically encodable cell-type-specific protein synthesis inhibitor. Heumuller M, Glock C, Rangaraju V, Biever A, Schuman EM. Nat Methods. 2019 Jul 15. pii: 10.1038/s41592-019-0468-x. doi: 10.1038/s41592-019-0468-x. 10.1038/s41592-019-0468-x PubMed 31308551