pFUW-tetO-mOrange
(Plasmid
#134298)
-
Purposedoxycycline-inducible expression of mouse mOrange in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134298 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFUW-tetO
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemOrange
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer TCCACGCTGTTTTGACCTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUW-tetO-mOrange was a gift from Kateri Moore & Filipe Pereira (Addgene plasmid # 134298 ; http://n2t.net/addgene:134298 ; RRID:Addgene_134298) -
For your References section:
Induction of a hemogenic program in mouse fibroblasts. Pereira CF, Chang B, Qiu J, Niu X, Papatsenko D, Hendry CE, Clark NR, Nomura-Kitabayashi A, Kovacic JC, Ma'ayan A, Schaniel C, Lemischka IR, Moore K. Cell Stem Cell. 2013 Aug 1;13(2):205-18. doi: 10.1016/j.stem.2013.05.024. Epub 2013 Jun 13. 10.1016/j.stem.2013.05.024 PubMed 23770078