Skip to main content

pHCL151
(Plasmid #134455)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134455 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMT178
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5a(lpir)
  • Growth instructions
    7.5 ug/ml tetracycline works optimally for selection.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    linker-mScarlet-I for C-terminal fusion
  • Promoter plac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ACACTTTATGCTTCCGGCTC
  • 3′ sequencing primer GACGAAAGTGATTGCGCCTACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHCL151 was a gift from Thomas Bernhardt (Addgene plasmid # 134455 ; http://n2t.net/addgene:134455 ; RRID:Addgene_134455)
  • For your References section:

    A PopZ-Linked Apical Recruitment Assay for Studying Protein-Protein Interactions in the Bacterial Cell Envelope. Lim HC, Bernhardt TG. Mol Microbiol. 2019 Sep 24. doi: 10.1111/mmi.14391. 10.1111/mmi.14391 PubMed 31550057