pHCL151
(Plasmid
#134455)
-
PurposeTetR, lacI-Plac-ssdsbA-mscarN, Integrative plasmid for the expression of fully-screted prey. N-terminal mScarlet-I fusion.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134455 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMT178
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5a(lpir)
-
Growth instructions7.5 ug/ml tetracycline works optimally for selection.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namelinker-mScarlet-I for C-terminal fusion
- Promoter plac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ACACTTTATGCTTCCGGCTC
- 3′ sequencing primer GACGAAAGTGATTGCGCCTACC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHCL151 was a gift from Thomas Bernhardt (Addgene plasmid # 134455 ; http://n2t.net/addgene:134455 ; RRID:Addgene_134455) -
For your References section:
A PopZ-Linked Apical Recruitment Assay for Studying Protein-Protein Interactions in the Bacterial Cell Envelope. Lim HC, Bernhardt TG. Mol Microbiol. 2019 Sep 24. doi: 10.1111/mmi.14391. 10.1111/mmi.14391 PubMed 31550057