Skip to main content

GFP-Myo 1c
(Plasmid #134832)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134832 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4708
  • Total vector size (bp) 8328
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo 1c (rat) with 3' UTR
  • Alt name
    Myr 2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3620
  • GenBank ID
    X74800
  • Entrez Gene
    Myo1c (a.k.a. Myr2)
  • Promoter CMV IE
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer EGFP-C CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Myo 1c was a gift from Martin Bähler (Addgene plasmid # 134832 ; http://n2t.net/addgene:134832 ; RRID:Addgene_134832)
  • For your References section:

    Localization of the rat myosin I molecules myr 1 and myr 2 and in vivo targeting of their tail domains. Ruppert C, Godel J, Muller RT, Kroschewski R, Reinhard J, Bahler M. J Cell Sci. 1995 Dec;108 ( Pt 12):3775-86. PubMed 8719884