GFP-Myo 1c
(Plasmid
#134832)
-
PurposeExpression of rat Myo 1c (Myr 2) in mammalian cells. N-terminal GFP-tag.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134832 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4708
- Total vector size (bp) 8328
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyo 1c (rat) with 3' UTR
-
Alt nameMyr 2
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3620
-
GenBank IDX74800
-
Entrez GeneMyo1c (a.k.a. Myr2)
- Promoter CMV IE
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer EGFP-C CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Myo 1c was a gift from Martin Bähler (Addgene plasmid # 134832 ; http://n2t.net/addgene:134832 ; RRID:Addgene_134832) -
For your References section:
Localization of the rat myosin I molecules myr 1 and myr 2 and in vivo targeting of their tail domains. Ruppert C, Godel J, Muller RT, Kroschewski R, Reinhard J, Bahler M. J Cell Sci. 1995 Dec;108 ( Pt 12):3775-86. PubMed 8719884