pLVX-EF1a-GalT-IRES-Puromycin
(Plasmid
#134862)
-
PurposeExpresses EGFP-tagged Golgi marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLVX-EF1a-IRES-Puromycin
- Backbone size w/o insert (bp) 8825
- Total vector size (bp) 9807
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebeta 1,4-galactosyltransferase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)246
-
Mutationdeleted amino acids 83-398
-
Entrez GeneB4GALT1 (a.k.a. B4GAL-T1, CDG2D, GGTB2, GT1, GTB, beta4Gal-T1)
- Promoter EF1a
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGCGATGGAGTTTCCCCAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGalT sequence (1-246 bp) was subcloned from Clontech construct.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-EF1a-GalT-IRES-Puromycin was a gift from David Andrews (Addgene plasmid # 134862 ; http://n2t.net/addgene:134862 ; RRID:Addgene_134862) -
For your References section:
A reference library for assigning protein subcellular localizations by image-based machine learning. Schormann W, Hariharan S, Andrews DW. J Cell Biol. 2020 Mar 2;219(3). pii: 133635. doi: 10.1083/jcb.201904090. 10.1083/jcb.201904090 PubMed 31968357