pFastbac1-Flag-FANCD2
(Plasmid
#134904)
-
Purposecodon optimized expression and purification of human FANCD2 in insect cells using baculovirus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134904 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastbac1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 9400
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFANCD2
-
Alt nameFanconi Anemia protein D2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4413
-
Mutationfully synthetic, codon optimized for insect expression
-
Entrez GeneFANCD2 (a.k.a. FA-D2, FA4, FACD, FAD, FAD2, FANCD)
- Promoter polyhedron
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TATTCCGGATTATTCATACC
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byfully synthetic gene, generated by Gene Universal
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For information regarding protein production from this plasmid, please see Tan et al, Plos One, 2020
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastbac1-Flag-FANCD2 was a gift from Andrew Deans (Addgene plasmid # 134904 ; http://n2t.net/addgene:134904 ; RRID:Addgene_134904) -
For your References section:
Preparation and purification of mono-ubiquitinated proteins using Avi-tagged ubiquitin. Tan W, Murphy VJ, Charron A, van Twest S, Sharp M, Constantinou A, Parker MW, Crismani W, Bythell-Douglas R, Deans AJ. PLoS One. 2020 Feb 24;15(2):e0229000. doi: 10.1371/journal.pone.0229000. eCollection 2020. 10.1371/journal.pone.0229000 PubMed 32092106