pL40C_PGKintron_Cas9_Green
(Plasmid
#134966)
-
PurposeLentiviral vector coding Cas9 and mNeonGreen
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134966 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneL40C
- Backbone size w/o insert (bp) 7926
- Total vector size (bp) 12951
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9-P2A-mNeonGreen
-
SpeciesStreptococcus pyogenes
- Promoter hPGK promoter with beta-globin intron
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer cccctctgctaaccatgttcatg (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pL40C_PGKintron_Cas9_Green was derived by subcloning the hPGK promoter with beta-globin intron from Tet-pLKO-puro (Addgene #21915) into the L40C-CRISPR.EFS.mNeon.NL.SL vector (a gift from Dirk Heckl, Martin Luther University Halle-Wittenberg) using PacI and BamHI sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL40C_PGKintron_Cas9_Green was a gift from Beat Bornhauser (Addgene plasmid # 134966 ; http://n2t.net/addgene:134966 ; RRID:Addgene_134966) -
For your References section:
The Leukemogenic TCF3-HLF Complex Rewires Enhancers Driving Cellular Identity and Self-Renewal Conferring EP300 Vulnerability. Huang Y, Mouttet B, Warnatz HJ, Risch T, Rietmann F, Frommelt F, Ngo QA, Dobay MP, Marovca B, Jenni S, Tsai YC, Matzk S, Amstislavskiy V, Schrappe M, Stanulla M, Gstaiger M, Bornhauser B, Yaspo ML, Bourquin JP. Cancer Cell. 2019 Dec 9;36(6):630-644.e9. doi: 10.1016/j.ccell.2019.10.004. Epub 2019 Nov 14. 10.1016/j.ccell.2019.10.004 PubMed 31735627