Skip to main content

Myo 19-GFP
(Plasmid #134988)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134988 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4713
  • Total vector size (bp) 7633
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo 19
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2920
  • GenBank ID
    AK 304073
  • Entrez Gene
    MYO19 (a.k.a. MYOHD1)
  • Promoter CMV IE
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site EcoR I (not destroyed)
  • 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer EGFP-N CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

this article is published:
Stefanie J. Oeding, Katarzyna Majstrowicz, Xiao-Ping Hu, Vera Schwarz, Angelika Freitag, Ulrike Honnert, Petra Nikolaus, Martin Bähler
Journal of Cell Science 2018 131: jcs219469 doi: 10.1242/jcs.219469 Published 10 September 2018

The Myo 19 cDNA was obtained from NITE Biological Resource Center (NBRC), Japan.
cDNA clone AK304073/FLJ61052/TRACH3006685

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Myo 19-GFP was a gift from Martin Bähler (Addgene plasmid # 134988 ; http://n2t.net/addgene:134988 ; RRID:Addgene_134988)
  • For your References section:

    Identification of Miro1 and Miro2 as mitochondrial receptors for myosin XIX. Oeding SJ, Majstrowicz K, Hu XP, Schwarz V, Freitag A, Honnert U, Nikolaus P, Bahler M. J Cell Sci. 2018 Sep 10;131(17). pii: jcs.219469. doi: 10.1242/jcs.219469. 10.1242/jcs.219469 PubMed 30111583