pKT2-ACVR1-G328V-IRES-Katushka
(Plasmid #135002)

• Purpose: Expresses ACVR1 with a G328V mutation and katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.
• Depositing Lab: Maria Castro
• Publication: Mendez et al Clin Cancer Res. 2020 Aug 1;26(15):4080-4092. doi: 10.1158/1078-0432.CCR-19-3714. Epub 2020 Apr 24.

Backbone

• Vector backbone: pKT2-IRES-Katushka
• Backbone size w/o insert (bp): 4894
• Total vector size (bp): 6424
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Activin A receptor, type I (ACVR1) G328V
• Species: H. sapiens (human)
• Insert Size (bp): 1530
• Mutation: c.983G>T, p.G328V
• Entrez Gene: ACVR1 (a.k.a. ACTRI, ACVR1A, ACVRLK2, ALK2, FOP, SKR1, TSRI)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CAGTGCAGGAAAAGTGGCAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ACVR1 was modified from pCMV5-ALK2-WT (Addgene plasmid #11741).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry