pKT2-ACVR1-G328V-IRES-Katushka
(Plasmid
#135002)
-
PurposeExpresses ACVR1 with a G328V mutation and katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135002 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKT2-IRES-Katushka
- Backbone size w/o insert (bp) 4894
- Total vector size (bp) 6424
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameActivin A receptor, type I (ACVR1) G328V
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1530
-
Mutationc.983G>T, p.G328V
-
Entrez GeneACVR1 (a.k.a. ACTRI, ACVR1A, ACVRLK2, ALK2, FOP, SKR1, TSRI)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAGTGCAGGAAAAGTGGCAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byACVR1 was modified from pCMV5-ALK2-WT (Addgene plasmid #11741).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKT2-ACVR1-G328V-IRES-Katushka was a gift from Maria Castro (Addgene plasmid # 135002 ; http://n2t.net/addgene:135002 ; RRID:Addgene_135002) -
For your References section:
Therapeutic Efficacy of Immune Stimulatory Thymidine Kinase and fms-like Tyrosine Kinase 3 Ligand (TK/Flt3L) Gene Therapy in a Mouse Model of High-Grade Brainstem Glioma. Mendez F, Kadiyala P, Nunez FJ, Carney S, Nunez FM, Gauss JC, Ravindran R, Pawar S, Edwards M, Garcia-Fabiani MB, Haase S, Lowenstein PR, Castro MG. Clin Cancer Res. 2020 Aug 1;26(15):4080-4092. doi: 10.1158/1078-0432.CCR-19-3714. Epub 2020 Apr 24. 10.1158/1078-0432.CCR-19-3714 PubMed 32332014