Myo 1b-myc
(Plasmid
#135064)
-
PurposeExpression of rat Myo 1b (Myr 1) in mammalian cells. C-terminal myc-tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135064 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV5
-
Backbone manufacturerDr. David Russell, UTSW
- Backbone size w/o insert (bp) 4603
- Total vector size (bp) 8200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyo 1b with 5' UTR
-
Alt nameMyr 1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3600
-
GenBank IDX68199
-
Entrez GeneMyo1b (a.k.a. Myr1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Linker (C terminal on insert)
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Eco RI (not destroyed)
- 3′ cloning site Xba I (not destroyed)
- 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer hGH-PA-R CCAGCTTGGTTCCCAATAGA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Myr 1 has three alternative spliceforms. In this plasmid spliceform Myr 1b is cloned, that exhibits a deletion of 29 amino acids.
The size of the 5' UTR is unknown, therefore the Insert size is estimated.
See also :
Ruppert C, Godel J, Muller RT, Kroschewski R, Reinhard J, Bahler M
J Cell Sci. 1995 Dec;108 ( Pt 12):3775-86. PubMed
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Myo 1b-myc was a gift from Martin Bähler (Addgene plasmid # 135064 ; http://n2t.net/addgene:135064 ; RRID:Addgene_135064) -
For your References section:
Identification, characterization and cloning of myr 1, a mammalian myosin-I. Ruppert C, Kroschewski R, Bahler M. J Cell Biol. 1993 Mar;120(6):1393-403. doi: 10.1083/jcb.120.6.1393. 10.1083/jcb.120.6.1393 PubMed 8449985