Skip to main content

Myo 1b-myc
(Plasmid #135064)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135064 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV5
  • Backbone manufacturer
    Dr. David Russell, UTSW
  • Backbone size w/o insert (bp) 4603
  • Total vector size (bp) 8200
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo 1b with 5' UTR
  • Alt name
    Myr 1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3600
  • GenBank ID
    X68199
  • Entrez Gene
    Myo1b (a.k.a. Myr1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Linker (C terminal on insert)
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Eco RI (not destroyed)
  • 3′ cloning site Xba I (not destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer hGH-PA-R CCAGCTTGGTTCCCAATAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Myr 1 has three alternative spliceforms. In this plasmid spliceform Myr 1b is cloned, that exhibits a deletion of 29 amino acids.
The size of the 5' UTR is unknown, therefore the Insert size is estimated.
See also :
Ruppert C, Godel J, Muller RT, Kroschewski R, Reinhard J, Bahler M
J Cell Sci. 1995 Dec;108 ( Pt 12):3775-86. PubMed

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Myo 1b-myc was a gift from Martin Bähler (Addgene plasmid # 135064 ; http://n2t.net/addgene:135064 ; RRID:Addgene_135064)
  • For your References section:

    Identification, characterization and cloning of myr 1, a mammalian myosin-I. Ruppert C, Kroschewski R, Bahler M. J Cell Biol. 1993 Mar;120(6):1393-403. doi: 10.1083/jcb.120.6.1393. 10.1083/jcb.120.6.1393 PubMed 8449985