pCZGY2729
(Plasmid
#135096)
-
PurposeSite specific insertion using CRISPR/Cas9 editing of C. elegans ChrIV
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135096 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCFJ201
- Backbone size w/o insert (bp) 7654
- Total vector size (bp) 12520
-
Modifications to backboneReplacement of Punc-119 driven unc-119 with hygromycin resistance driven by a ubiquitous promoter.
-
Vector typeWorm Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHygromycin resistance
- Promoter rps-0
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ggaacaaaggagttcagatcctgtg
- 3′ sequencing primer AGCCAGTCTGCAGGTCGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZGY2729 was a gift from Yishi Jin (Addgene plasmid # 135096 ; http://n2t.net/addgene:135096 ; RRID:Addgene_135096) -
For your References section:
Inhibition of Axon Regeneration by Liquid-like TIAR-2 Granules. Andrusiak MG, Sharifnia P, Lyu X, Wang Z, Dickey AM, Wu Z, Chisholm AD, Jin Y. Neuron. 2019 Jul 24. pii: S0896-6273(19)30602-6. doi: 10.1016/j.neuron.2019.07.004. 10.1016/j.neuron.2019.07.004 PubMed 31378567