Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCZGY2729
(Plasmid #135096)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135096 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCFJ201
  • Backbone size w/o insert (bp) 7654
  • Total vector size (bp) 12520
  • Modifications to backbone
    Replacement of Punc-119 driven unc-119 with hygromycin resistance driven by a ubiquitous promoter.
  • Vector type
    Worm Expression, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hygromycin resistance
  • Promoter rps-0

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggaacaaaggagttcagatcctgtg
  • 3′ sequencing primer AGCCAGTCTGCAGGTCGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCZGY2729 was a gift from Yishi Jin (Addgene plasmid # 135096 ; http://n2t.net/addgene:135096 ; RRID:Addgene_135096)
  • For your References section:

    Inhibition of Axon Regeneration by Liquid-like TIAR-2 Granules. Andrusiak MG, Sharifnia P, Lyu X, Wang Z, Dickey AM, Wu Z, Chisholm AD, Jin Y. Neuron. 2019 Jul 24. pii: S0896-6273(19)30602-6. doi: 10.1016/j.neuron.2019.07.004. 10.1016/j.neuron.2019.07.004 PubMed 31378567