pBIP1::eYFP
(Plasmid
#135231)
-
PurposeUPR signaling reporter (upregulates eYFP expression under UPR conditions)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135231 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGGZ001
-
Backbone manufacturerAddgene plasmid # 48868
- Backbone size w/o insert (bp) 2687
- Total vector size (bp) 6975
-
Modifications to backboneN/A
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepBiP1
-
Alt nameBiP1 promoter
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1198
- Promoter BiP1
-
Tag
/ Fusion Protein
- eYFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TAGGCTCGGACGAAGTAAGC
- 3′ sequencing primer ATACAAGGCCCCAAAACACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/825190v1?rss=1 for bioRxiv preprint.
Please see the attached genbank file for an BIP1 annotated plasmid map.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBIP1::eYFP was a gift from Armin Djamei (Addgene plasmid # 135231 ; http://n2t.net/addgene:135231 ; RRID:Addgene_135231) -
For your References section:
A high-throughput screening method to identify proteins involved in unfolded protein response of the endoplasmic reticulum in plants. Alcantara A, Seitner D, Navarrete F, Djamei A. Plant Methods. 2020 Jan 21;16:4. doi: 10.1186/s13007-020-0552-3. eCollection 2020. 10.1186/s13007-020-0552-3 PubMed 31988651