Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEM01
(Plasmid #135414)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135414 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS406
  • Backbone size w/o insert (bp) 4287
  • Total vector size (bp) 6475
  • Modifications to backbone
    Insert including CMVpr driving hph (HygR) and ADH1 terminator
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CMVpr hph ADH1t
  • Alt name
    CMV promoter HygR ADH1 terminator
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    2188
  • GenBank ID
    YP_007349547.1 854068
  • Promoter CMVpr

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CACTTTATGCTTCCGGCTCCTATGTT
  • 3′ sequencing primer CTGCCGGTAGAGGTGTGGTCAATA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    CMVpr from pAB1T7 / hph from pRS306H / ADH1t from pNB780 /

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEM01 was a gift from Nicolas Buchler (Addgene plasmid # 135414 ; http://n2t.net/addgene:135414 ; RRID:Addgene_135414)
  • For your References section:

    Genetic transformation of Spizellomyces punctatus, a resource for studying chytrid biology and evolutionary cell biology. Medina EM, Robinson KA, Bellingham-Johnstun K, Ianiri G, Laplante C, Fritz-Laylin LK, Buchler NE. Elife. 2020 May 11;9. pii: 52741. doi: 10.7554/eLife.52741. 10.7554/eLife.52741 PubMed 32392127
Commonly requested with: