Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEM09
(Plasmid #135479)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135479 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS406
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpunHsp70pr
  • Alt name
    Spizellomyces Hsp70pr
  • Species
    Spizellomyces punctatus
  • Insert Size (bp)
    1070
  • Promoter Spun Hsp70pr
  • Tags / Fusion Proteins
    • hph
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CACTTTATGCTTCCGGCTCCTATGTT
  • 3′ sequencing primer CTGCCGGTAGAGGTGTGGTCAATA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEM09 was a gift from Nicolas Buchler (Addgene plasmid # 135479 ; http://n2t.net/addgene:135479 ; RRID:Addgene_135479)
  • For your References section:

    Genetic transformation of Spizellomyces punctatus, a resource for studying chytrid biology and evolutionary cell biology. Medina EM, Robinson KA, Bellingham-Johnstun K, Ianiri G, Laplante C, Fritz-Laylin LK, Buchler NE. Elife. 2020 May 11;9. pii: 52741. doi: 10.7554/eLife.52741. 10.7554/eLife.52741 PubMed 32392127
Commonly requested with: