Skip to main content

pAAV-Ef1a-Flex-Axon-GCaMP7b
(Plasmid #135419)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135419 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s
  • Backbone manufacturer
    Rylan Larsen (Allen Institute for Brain Science)
  • Backbone size w/o insert (bp) 5897
  • Total vector size (bp) 6662
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    axon-jGCaMP7b
  • Alt name
    Axon-GCaMP3 variant 1561
  • Alt name
    Axon-Janelia-GCaMP7b
  • Species
    R. norvegicus (rat), G. gallus (chicken); A. victoria
  • Insert Size (bp)
    1568
  • Promoter Ef1a
  • Tags / Fusion Proteins
    • GAP43 palmitoylation domain (N terminal on insert)
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site SwaI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    GCaMP7b was synthesized based on sequences published by Douglas Kim and the Janelia Research Campus in Dana et al, 2019 PMID:31209382 . The Axon(Gap43) targeting sequence fused to GCaMP7b was previously published by Lin Tian's lab in Broussard et al, 2018 PMID: PMC6697169.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-Flex-Axon-GCaMP7b was a gift from Rylan Larsen (Addgene plasmid # 135419 ; http://n2t.net/addgene:135419 ; RRID:Addgene_135419)