pGL3-Basic-hCYP26A1-FL- luciferase
(Plasmid
#135566)
-
PurposeFull Length promoter of the human CYP26A1 gene in pGL3-Basic-luciferase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL3-Basic-luciferase
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 6968
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFollow the protocol from Promega.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFull-length promoter of human retinoic acid receptor-beta gene
-
Alt nameCYP26A1P
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2150
- Promoter hHuman CYP26A1 gene promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AGCAAGCTTGTACAGATAGATTAAAACGT
- 3′ sequencing primer AATAAGCTTCACGAAGGTGCAGAGCGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PCR amplified full-length (FL) promoter of the human CYP26A1 gene was cloned from the FOSMID vector into HindIII site of the pGL3 Basic Luciferase reporter vector (see Zhang et. al, 2010, Gene 464: 32–43). An isolated clone was digested with AscI and AleI and then re-ligated to form pGL3-Basic-hCYP26A1-FL-luciferase clone containing the FL promoter covering from −2139 5’upstream to + 11 3’downstream position of the transcription start site in the gene. An isolated pGL3-Basic-hCYP26A1-FL-luciferase clone was submitted to sequencing for confirmation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Basic-hCYP26A1-FL- luciferase was a gift from Catharine Ross (Addgene plasmid # 135566 ; http://n2t.net/addgene:135566 ; RRID:Addgene_135566) -
For your References section:
Hepatocyte nuclear factor 4alpha (HNF4alpha) in coordination with retinoic acid receptors increases all-trans-retinoic acid-dependent CYP26A1 gene expression in HepG2 human hepatocytes. Zolfaghari R, Ross AC. J Cell Biochem. 2014 Oct;115(10):1740-51. doi: 10.1002/jcb.24839. 10.1002/jcb.24839 PubMed 24819304