pLGB36
(Plasmid
#135621)
-
PurposeSuicide vector for allelic replacement in Bacteroides species including B. fragilis strain 638R, erythromycin selection and aTC-inducible ss-Bfe3 counterselection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135621 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLGB13
- Backbone size w/o insert (bp) 4093
- Total vector size (bp) 5040
-
Modifications to backboness-bfe1 removed and replaced with ss-bfe3
-
Vector typeBacteroides suicide vector with inducible counter-selection toxin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)S17 lambda pir
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebfe3
-
Alt nameM136_1999
-
SpeciesBacteroides fragilis
-
Insert Size (bp)885
-
GenBank IDEXZ28783.1
- Promoter Bacteroides promoter regualted by TetR transcriptional regulator
-
Tag
/ Fusion Protein
- signal sequence for periplasmic targeting (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acatataaaagaaaagacacatgaagaaaattttatctttgc
- 3′ sequencing primer ctgcagcccgggggatccactcatctgatactatgccaatg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLGB36 was a gift from Laurie Comstock (Addgene plasmid # 135621 ; http://n2t.net/addgene:135621 ; RRID:Addgene_135621) -
For your References section:
Genetic and Biochemical Analysis of Anaerobic Respiration in Bacteroides fragilis and Its Importance In Vivo. Ito T, Gallegos R, Matano LM, Butler NL, Hantman N, Kaili M, Coyne MJ, Comstock LE, Malamy MH, Barquera B. mBio. 2020 Feb 4;11(1). pii: mBio.03238-19. doi: 10.1128/mBio.03238-19. 10.1128/mBio.03238-19 PubMed 32019804