PX330_ELK1_iso1_1
(Plasmid
#135757)
-
PurposeEncodes gRNA for 3' target of human ELK1_iso1
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX330
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameELK1_iso1 gRNA
-
gRNA/shRNA sequenceGGTAGTAGTCATGGCTTCTG
-
SpeciesH. sapiens (human)
-
Entrez GeneELK1
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX330_ELK1_iso1_1 was a gift from Richard M. Myers (Addgene plasmid # 135757 ; http://n2t.net/addgene:135757 ; RRID:Addgene_135757) -
For your References section:
CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Savic D, Partridge EC, Newberry KM, Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. Genome Res. 2015 Sep 9. 10.1101/gr.193540.115 PubMed 26355004