PB-XL-AncBE4max
(Plasmid
#136254)
-
PurposeDoxycycline inducible piggyBAC plasmid for mammalian expression of cytosine base editor AncBE4max
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneXLone-GFP (Addgene plasmid no. 96930)
-
Backbone manufacturerXiaojun Lian
- Backbone size w/o insert (bp) 5638
- Total vector size (bp) 12004
-
Modifications to backboneGFP was replaced by the AncBE4max_GFP transgenes
-
Vector typeMammalian Expression, CRISPR ; piggyBAC DNA transposon
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAncBE4max_GFP
-
SpeciesSynthetic
-
Insert Size (bp)6366
-
MutationThe AncBE4max_GFP insert was PCR amplified from addgene plasmid#112100
- Promoter TRE3G
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTTTGCTTATGTAAACCAG
- 3′ sequencing primer GGATTAGGCAGTAGCTCTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid# 112100
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-XL-AncBE4max was a gift from Zhaohui Ye (Addgene plasmid # 136254 ; http://n2t.net/addgene:136254 ; RRID:Addgene_136254) -
For your References section:
Targeting specificity of APOBEC-based cytosine base editor in human iPSCs determined by whole genome sequencing. McGrath E, Shin H, Zhang L, Phue JN, Wu WW, Shen RF, Jang YY, Revollo J, Ye Z. Nat Commun. 2019 Nov 25;10(1):5353. doi: 10.1038/s41467-019-13342-8. 10.1038/s41467-019-13342-8 PubMed 31767844