Skip to main content

PB-XL-AncBE4max
(Plasmid #136254)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136254 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    XLone-GFP (Addgene plasmid no. 96930)
  • Backbone manufacturer
    Xiaojun Lian
  • Backbone size w/o insert (bp) 5638
  • Total vector size (bp) 12004
  • Modifications to backbone
    GFP was replaced by the AncBE4max_GFP transgenes
  • Vector type
    Mammalian Expression, CRISPR ; piggyBAC DNA transposon
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AncBE4max_GFP
  • Species
    Synthetic
  • Insert Size (bp)
    6366
  • Mutation
    The AncBE4max_GFP insert was PCR amplified from addgene plasmid#112100
  • Promoter TRE3G

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGCTTTGCTTATGTAAACCAG
  • 3′ sequencing primer GGATTAGGCAGTAGCTCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid# 112100

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-XL-AncBE4max was a gift from Zhaohui Ye (Addgene plasmid # 136254 ; http://n2t.net/addgene:136254 ; RRID:Addgene_136254)
  • For your References section:

    Targeting specificity of APOBEC-based cytosine base editor in human iPSCs determined by whole genome sequencing. McGrath E, Shin H, Zhang L, Phue JN, Wu WW, Shen RF, Jang YY, Revollo J, Ye Z. Nat Commun. 2019 Nov 25;10(1):5353. doi: 10.1038/s41467-019-13342-8. 10.1038/s41467-019-13342-8 PubMed 31767844