Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #136254)


Item Catalog # Description Quantity Price (USD)
Plasmid 136254 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    XLone-GFP (Addgene plasmid no. 96930)
  • Backbone manufacturer
    Xiaojun Lian
  • Backbone size w/o insert (bp) 5638
  • Total vector size (bp) 12004
  • Modifications to backbone
    GFP was replaced by the AncBE4max_GFP transgenes
  • Vector type
    Mammalian Expression, CRISPR ; piggyBAC DNA transposon
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Mutation
    The AncBE4max_GFP insert was PCR amplified from addgene plasmid#112100
  • Promoter TRE3G

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGCTTTGCTTATGTAAACCAG
  • 3′ sequencing primer GGATTAGGCAGTAGCTCTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-XL-AncBE4max was a gift from Zhaohui Ye (Addgene plasmid # 136254 ; ; RRID:Addgene_136254)
  • For your References section:

    Targeting specificity of APOBEC-based cytosine base editor in human iPSCs determined by whole genome sequencing. McGrath E, Shin H, Zhang L, Phue JN, Wu WW, Shen RF, Jang YY, Revollo J & Ye Z.. (2019) Nat Commun 10, 5353 10.1038/s41467-019-13342-8