-
Purpose(Empty Backbone) Expression of N-terminal HaloTag-fused proteins in mammalian cells. Genes can be cloned using Gateway cloning system. Cloned vectors can be used for NanoBRET assay.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHTN HaloTag CMV-neo
-
Backbone manufacturerPromega
- Backbone size (bp) 7892
-
Modifications to backboneattR1 and attR2 sites for Gateway recombination, ccdB cassette and CmR for selection in bacteria
-
Vector typeMammalian Expression
- Promoter CMV
-
Selectable markersNeomycin (select with G418)
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsafter cloning the ccdB-CmR cassette is lost and only Ampicillin can be used for selection
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHTNW was a gift from Sebastian Maurer (Addgene plasmid # 136403 ; http://n2t.net/addgene:136403 ; RRID:Addgene_136403) -
For your References section:
rec-YnH enables simultaneous many-by-many detection of direct protein-protein and protein-RNA interactions. Yang JS, Garriga-Canut M, Link N, Carolis C, Broadbent K, Beltran-Sastre V, Serrano L, Maurer SP. Nat Commun. 2018 Sep 14;9(1):3747. doi: 10.1038/s41467-018-06128-x. 10.1038/s41467-018-06128-x PubMed 30217970