Skip to main content
Addgene

pRetroX-TRE3G-PLOD2_PGK-GpNLuc
(Plasmid #136457)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136457 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRetroX-Tight-MCS_PGK-GpNLuc
  • Backbone size w/o insert (bp) 7186
  • Total vector size (bp) 10527
  • Modifications to backbone
    TRE3G was cloned into the RetroX backbone by excising pTight from pRetroX-Tight-MCS_PGK-GpNLuc (Addgene #70185) using XhoI and BamHI. TRE3G was PCR amplified from (https://www.addgene.org/85449/) and XhoI/BamHI sites were appended during PCR reaction. RetroX-TRE3G was digested with BamHI and EcoRI, and BamHI-PLOD2-XbaI and XbaI-T2A-Hygro-EcoRI amplicons were ligated into the new backbone.
  • Vector type
    Mammalian Expression, Retroviral, Luciferase
  • Selectable markers
    eGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRE3G::PLOD2-T2A-Hygromycin
  • Alt name
    PLOD2
  • Alt name
    procollagen-lysine,2-oxoglutarate 5-dioxygenase 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3737
  • GenBank ID
    5352
  • Entrez Gene
    PLOD2 (a.k.a. BRKS2, LH2, TLH)
  • Promoter TRE3G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRetroX-TRE3G-PLOD2_PGK-GpNLuc was a gift from Antonio Amelio (Addgene plasmid # 136457 ; http://n2t.net/addgene:136457 ; RRID:Addgene_136457)
  • For your References section:

    Lysyl hydroxylase 2-induced collagen cross-link switching promotes metastasis in head and neck squamous cell carcinomas. Sato K, Parag-Sharma K, Terajima M, Musicant AM, Murphy RM, Ramsey MR, Hibi H, Yamauchi M, Amelio AL. Neoplasia. 2021 Jun 6;23(6):594-606. doi: 10.1016/j.neo.2021.05.014. 10.1016/j.neo.2021.05.014 PubMed 34107376