Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #73501)


Item Catalog # Description Quantity Price (USD)
Plasmid 73501 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 9596
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • gRNA/shRNA sequence
    Scramble gRNA sequence with BsmBI cloning sites
  • Species
    H. sapiens (human), Synthetic
  • Promoter CAG
  • Tag / Fusion Protein
    • NLS (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer GATCTACCACATTTGTAGAG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Due to the large size of this gRNA expression vector it does not produce high-tire lentivirus. Hence we do not recommend using this plasmid backbone for lentivral preparation. This gRNA-expression plasmid is best suited for plasmid transfections and generation of stable clones.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pgRNA-CKB was a gift from Bruce Conklin (Addgene plasmid # 73501 ; ; RRID:Addgene_73501)
  • For your References section:

    CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Mandegar MA, Huebsch N, Frolov EB, Shin E, Truong A, Olvera MP, Chan AH, Miyaoka Y, Holmes K, Spencer CI, Judge LM, Gordon DE, Eskildsen TV, Villalta JE, Horlbeck MA, Gilbert LA, Krogan NJ, Sheikh SP, Weissman JS, Qi LS, So PL, Conklin BR. Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10. 10.1016/j.stem.2016.01.022 PubMed 26971820