-
PurposeMammalian expression of cytosolic side of plasma membrane targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imaging
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136465 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 9296
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHyPer7
-
Insert Size (bp)1437
- Promoter CMV
-
Tag
/ Fusion Protein
- Farnselation tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aggtctatataagcagagctcg
- 3′ sequencing primer GTCATAGCTGTTTCCTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HyPer7-MEM was a gift from Vsevolod Belousov (Addgene plasmid # 136465 ; http://n2t.net/addgene:136465 ; RRID:Addgene_136465) -
For your References section:
Ultrasensitive Genetically Encoded Indicator for Hydrogen Peroxide Identifies Roles for the Oxidant in Cell Migration and Mitochondrial Function. Pak VV, Ezerina D, Lyublinskaya OG, Pedre B, Tyurin-Kuzmin PA, Mishina NM, Thauvin M, Young D, Wahni K, Martinez Gache SA, Demidovich AD, Ermakova YG, Maslova YD, Shokhina AG, Eroglu E, Bilan DS, Bogeski I, Michel T, Vriz S, Messens J, Belousov VV. Cell Metab. 2020 Mar 3;31(3):642-653.e6. doi: 10.1016/j.cmet.2020.02.003. 10.1016/j.cmet.2020.02.003 PubMed 32130885