Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCMV-HyPer7-MEM
(Plasmid #136465)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 136465 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV
  • Total vector size (bp) 9296
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HyPer7
  • Insert Size (bp)
    1437
  • Promoter CMV
  • Tag / Fusion Protein
    • Farnselation tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aggtctatataagcagagctcg
  • 3′ sequencing primer GTCATAGCTGTTTCCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-HyPer7-MEM was a gift from Vsevolod Belousov (Addgene plasmid # 136465 ; http://n2t.net/addgene:136465 ; RRID:Addgene_136465)
  • For your References section:

    Ultrasensitive Genetically Encoded Indicator for Hydrogen Peroxide Identifies Roles for the Oxidant in Cell Migration and Mitochondrial Function. Pak VV, Ezerina D, Lyublinskaya OG, Pedre B, Tyurin-Kuzmin PA, Mishina NM, Thauvin M, Young D, Wahni K, Martinez Gache SA, Demidovich AD, Ermakova YG, Maslova YD, Shokhina AG, Eroglu E, Bilan DS, Bogeski I, Michel T, Vriz S, Messens J, Belousov VV. Cell Metab. 2020 Mar 3;31(3):642-653.e6. doi: 10.1016/j.cmet.2020.02.003. 10.1016/j.cmet.2020.02.003 PubMed 32130885