Skip to main content
Addgene

pCMV-HyPer7-MEM
(Plasmid #136465)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136465 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Total vector size (bp) 9296
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HyPer7
  • Insert Size (bp)
    1437
  • Promoter CMV
  • Tag / Fusion Protein
    • Farnselation tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aggtctatataagcagagctcg
  • 3′ sequencing primer GTCATAGCTGTTTCCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-HyPer7-MEM was a gift from Vsevolod Belousov (Addgene plasmid # 136465 ; http://n2t.net/addgene:136465 ; RRID:Addgene_136465)
  • For your References section:

    Ultrasensitive Genetically Encoded Indicator for Hydrogen Peroxide Identifies Roles for the Oxidant in Cell Migration and Mitochondrial Function. Pak VV, Ezerina D, Lyublinskaya OG, Pedre B, Tyurin-Kuzmin PA, Mishina NM, Thauvin M, Young D, Wahni K, Martinez Gache SA, Demidovich AD, Ermakova YG, Maslova YD, Shokhina AG, Eroglu E, Bilan DS, Bogeski I, Michel T, Vriz S, Messens J, Belousov VV. Cell Metab. 2020 Mar 3;31(3):642-653.e6. doi: 10.1016/j.cmet.2020.02.003. 10.1016/j.cmet.2020.02.003 PubMed 32130885