Skip to main content

pQLinkN
(Plasmid #13670)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 13670 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQE-2
  • Backbone size w/o insert (bp) 4794
  • Vector type
    Bacterial Expression ; Co-expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    multi cloning site
  • Alt name
    pQToT
  • Insert Size (bp)
    29

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pQE65, TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer pQE276, GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the chloramphenicol resistance gene in this plasmid is incomplete. It is lacking a promoter, therefore it is supposed to be inactive.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQLinkN was a gift from Konrad Buessow (Addgene plasmid # 13670 ; http://n2t.net/addgene:13670 ; RRID:Addgene_13670)
  • For your References section:

    Vectors for co-expression of an unrestricted number of proteins. Scheich C, Kummel D, Soumailakakis D, Heinemann U, Bussow K. Nucleic Acids Res. 2007;35(6):e43. doi: 10.1093/nar/gkm067. Epub 2007 Feb 20. 10.1093/nar/gkm067 PubMed 17311810