-
Purposedonor plasmid for constitutive FUCCI expression in human cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136934 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAAVS1 Puro CAG
-
Backbone manufacturerAddgene Plasmid #80945
- Backbone size w/o insert (bp) 10235
- Total vector size (bp) 12890
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameClover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)
-
Alt nameFUCCI
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2655
- Promoter CAG
-
Tags
/ Fusion Proteins
- Clover (N terminal on insert)
- mKO2 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer gctaaccatgttcatgccttc
- 3′ sequencing primer none (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120) was cloned from Addgene #83841, a gift from Dr. Michael Lin Lab
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Puro CAG FUCCI was a gift from Xiaoping Bao (Addgene plasmid # 136934 ; http://n2t.net/addgene:136934 ; RRID:Addgene_136934) -
For your References section:
Fluorescent indicators for continuous and lineage-specific reporting of cell-cycle phases in human pluripotent stem cells. Chang Y, Hellwarth PB, Randolph LN, Sun Y, Xing Y, Zhu W, Lian XL, Bao X. Biotechnol Bioeng. 2020 Apr 11. doi: 10.1002/bit.27352. 10.1002/bit.27352 PubMed 32277708