Skip to main content

px330-GAPDH
(Plasmid #136940)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136940 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px330
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA targeting GAPDH
  • gRNA/shRNA sequence
    GTATAGAAACCGGGGGCGCGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    GAPDH (a.k.a. G3PD, GAPD, HEL-S-162eP)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (destroyed during cloning)
  • 3′ cloning site Bbs1 (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

First G base in the sgRNA is not in the target locus, but is needed for transcription.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px330-GAPDH was a gift from Jeremy Stark (Addgene plasmid # 136940 ; http://n2t.net/addgene:136940 ; RRID:Addgene_136940)
  • For your References section:

    The canonical non-homologous end joining factor XLF promotes chromosomal deletion rearrangements in human cells. Bhargava R, Lopezcolorado FW, Tsai LJ, Stark JM. J Biol Chem. 2019 Nov 21. pii: RA119.010421. doi: 10.1074/jbc.RA119.010421. 10.1074/jbc.RA119.010421 PubMed 31753920