pRSET-TEV-12His
(Plasmid
#137032)
-
Purpose(Empty Backbone) empty vector; C-terminal TEV-protease-cleavable His12; T7 promoter; BseRI cloning sites (e.g., In-Fusion compatible)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137032 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSET-C8xHis (DNASU access no. EvNO00629010)
-
Vector typeBacterial Expression
- Promoter T7
-
Tag
/ Fusion Protein
- His12 (TEV protease cleavable) (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This empty vector is designed to allow cloning between two BseRI restriction sites that flank a removable 432 bp insert. BseRI cleavage occurs outside of its recognition sequence, thus avoiding inclusion of any of the BseRI recognition sequence in the final expressed protein sequence. A compatible ligation-independent system is In-Fusion.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSET-TEV-12His was a gift from Debra Hansen (Addgene plasmid # 137032 ; http://n2t.net/addgene:137032 ; RRID:Addgene_137032) -
For your References section:
Membrane directed expression in Escherichia coli of BBA57 and other virulence factors from the Lyme disease agent Borrelia burgdorferi. Robertson KE, Truong CD, Craciunescu FM, Chiu PL, Fromme P, Hansen DT. Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x. 10.1038/s41598-019-53830-x PubMed 31772280