Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pelB-MBP-DipA-ss
(Plasmid #137068)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 137068 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pelB-MBP (DNASU access no. EvNO00813783)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    AAC66790.1
  • Alt name
    DipA BB0418
  • Species
    Borrelia burgdorferi B31
  • Mutation
    mature DipA: lacks the DipA signal peptide
  • Entrez Gene
    BB_0418 (a.k.a. BB_0418)
  • Promoter T7lac
  • Tag / Fusion Protein
    • PelB signal peptide + His10 + maltose binding protein + TEV protease cleavage (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GAAAGGTGAAATCATGCCGAACATC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid uses the T7lac promoter to express in E. coli the mature (lacking the signal peptide), wild-type protein containing an N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavage site. The gene encoding the protein does not have the same DNA sequence as B. burgdorferi because the gene has been optimized for expression in E. coli.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pelB-MBP-DipA-ss was a gift from Debra Hansen (Addgene plasmid # 137068 ; http://n2t.net/addgene:137068 ; RRID:Addgene_137068)
  • For your References section:

    Membrane directed expression in Escherichia coli of BBA57 and other virulence factors from the Lyme disease agent Borrelia burgdorferi. Robertson KE, Truong CD, Craciunescu FM, Chiu PL, Fromme P, Hansen DT. Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x. 10.1038/s41598-019-53830-x PubMed 31772280