pCC1-4k-BBclone2
(Plasmid
#137070)
-
PurposeE. coli plasmid that contains the expression optimized genes for BB0323, P13, DipA and Lmp1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137070 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCC1-4k
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameBB0323
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
-
GenBank IDAAC66700.1
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ACGCCAGGGTTTTCCCAGTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameP13
-
Alt nameBB0034
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
-
GenBank IDAAC66426.1
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTTGGTTCGCGAACCGTCAG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameDipA
-
Alt nameBB0418
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
-
GenBank IDAAC66790.1
Cloning Information for Gene/Insert 3
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTTCGAACCGAGCTTTGACG (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameLmp1
-
Alt nameBB0210 YP_008686569.1
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
-
GenBank IDAAC66595.1
Cloning Information for Gene/Insert 4
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGGGTCTGGCGGACATCAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byordered from GenScript synthesis of the expression-optimized genes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For use as a PCR template for the expression optimized genes encoding BB0323, P13, DipA, Lmp1. RK2 origin of replication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCC1-4k-BBclone2 was a gift from Debra Hansen (Addgene plasmid # 137070 ; http://n2t.net/addgene:137070 ; RRID:Addgene_137070) -
For your References section:
Membrane directed expression in Escherichia coli of BBA57 and other virulence factors from the Lyme disease agent Borrelia burgdorferi. Robertson KE, Truong CD, Craciunescu FM, Chiu PL, Fromme P, Hansen DT. Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x. 10.1038/s41598-019-53830-x PubMed 31772280