Skip to main content

pAAV-Ef1a-Con/Foff 2.0-oScarlet
(Plasmid #137137)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137137 Standard format: Plasmid sent in bacteria as agar stab 1 $89
AAV8 137137-AAV8 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $437

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV2-EF1a-WPRE
  • Backbone size w/o insert (bp) 5300
  • Vector type
    AAV, Cre/Lox, Synthetic Biology ; Flp/FRT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Con/Foff 2.0-oScarlet
  • Species
    Synthetic; Prokaryotic
  • Insert Size (bp)
    1300
  • Mutation
    E95D
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer TGGAATTTGCCCTTTTTGAG
  • 3′ sequencing primer GGGCCACAACTCCTCATAAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG

Information for AAV8 (Catalog # 137137-AAV8) ( Back to top)

Purpose

Ready-to-use AAV8 particles produced from pAAV-Ef1a-Con/Foff 2.0-oScarlet (#137137). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Foff 2.0-oScarlet plasmid DNA.

EF1a-driven, Cre-dependent expression of oScarlet (inhibited in presence of Flp). These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $405 USD for preparation of 100 µL virus + $32 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene oScarlet (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-Con/Foff 2.0-oScarlet was a gift from Karl Deisseroth & INTRSECT 2.0 Project (Addgene plasmid # 137137 ; http://n2t.net/addgene:137137 ; RRID:Addgene_137137) For viral preps, please replace (Addgene plasmid # 137137) in the above sentence with: (Addgene viral prep # 137137-AAV8)
  • For your References section:

    Comprehensive Dual- and Triple-Feature Intersectional Single-Vector Delivery of Diverse Functional Payloads to Cells of Behaving Mammals. Fenno LE, Ramakrishnan C, Kim YS, Evans KE, Lo M, Vesuna S, Inoue M, Cheung KYM, Yuen E, Pichamoorthy N, Hong ASO, Deisseroth K. Neuron. 2020 Jun 20. pii: S0896-6273(20)30432-3. doi: 10.1016/j.neuron.2020.06.003. 10.1016/j.neuron.2020.06.003 PubMed 32574559