pcDNA3 PARL-FLAG-CT H335G
(Plasmid
#13749)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 13749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5446
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePresenilin-associated rhomboid-like
-
Alt namePARL
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1164
-
MutationChanged catalytic His 335 to Gly
-
GenBank IDAF197937
-
Entrez GenePARL (a.k.a. PRO2207, PSARL, PSARL1, PSENIP2, RHBDS1)
-
Entrez GenePARL (a.k.a. PARL)
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GTACGGTGGGAGGTCTATAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3 PARL-FLAG-CT H335G was a gift from Luca Pellegrini (Addgene plasmid # 13749 ; http://n2t.net/addgene:13749 ; RRID:Addgene_13749) -
For your References section:
Mitochondrial rhomboid PARL regulates cytochrome c release during apoptosis via OPA1-dependent cristae remodeling. Cipolat S, Rudka T, Hartmann D, Costa V, Serneels L, Craessaerts K, Metzger K, Frezza C, Annaert W, D'Adamio L, Derks C, Dejaegere T, Pellegrini L, D'Hooge R, Scorrano L, De Strooper B. Cell. 2006 Jul 14. 126(1):163-75. 10.1016/j.cell.2006.06.021 PubMed 16839884